Please browse an image to upload.
| #LINK | ||
| #lang | en | |
| #attribution_name | GenoCon | |
| #attribution_url | http://atted.jp/download.shtml | |
| #license | http://creativecommons.org/publicdomain/zero/1.0/deed.ja | |
| #file_name | tooltip_PromoterCAD_menus_buttons | |
| #download_from | http://linkdata.org/work/rdf1s464i | |
| #namespace | PubMed | http://www.ncbi.nlm.nih.gov/pubmed/ |
| #property | explanation | PubMed |
| #object_type_xsd | string | string |
| #property_context | Assertion | Assertion |
| atgenexpress | Database of microarray expression measurements for different developmental tissues of Arabidopsis thaliana. | PubMed:15806101 |
| diurnal | Database of microarray expression measurements for seedling Arabidopsis thaliana plants grown in a variety of conditions. | PubMed:18419293 |
| selectexpressiondatabase | A series of measurements of many genes in the target organism, changing variables such as the developmental tissue (AtGenExpress) or the time of day each gene is measured (DIURNAL). | |
| atted-ii | A database which uses the AtGenExpress microarray data set to compare genes with similar expression patterns and look for 7 base-pair motifs they have in common. This database also predicts the location at which a given motif might be most effective. | PubMed:17130150 |
| ppdb | The Plant Promoter Database. Plant Promoters are analyzed by word frequency in a region 500 base-pairs upstream of the Transcriptional Start Site, using 8 base-pair motifs. These motifs are used to categorize regulatory elements, along with TATA box and Y-patch features. | PubMed:17346352 |
| selectmotifdatabase | Choose the database for the regulatory motif annotations that will be extracted from the promoters. There are several methods for predicting and annotating regulatory motifs. | |
| selecttool | Pick the data mining tool for searching the Gene Expression Properties for genes of interest. Note that not all tools are compatible with all databases. | |
| motifexpress | This tool finds the gene associated with the maximum or minimum value of a selected gene expression property, and returns motifs identified from that gene. | |
| motifcircadian | This tool searches for genes which have a large circadian amplitude, and returns motifs identified from that gene. | |
| motifrank | This tool finds the gene associated with the maximum or minimum value of a selected gene expression property, and returns motifs identified from that gene. The user is able to select from the top 10 genes for a given property. Contributed by Mochizuki san. | |
| motifquery | This tool combines search criteria from several gene expression properties, to find genes with useful expression profiles. | |
| userinputmotif | Since users my have prior knowledge of specific regulatory motifs, we provide a simple interface to allow users to input such data and use it for PromoterCAD designs. | |
| selectdatatable | Collection of Gene Expression Properties organized by type, such as tissues involved in the same organ (flowering), or data time courses taken in the same growth condition. | |
| selectproperty | The Gene Expression Property used by the data mining Tool. This may be a raw data value, such as gene expression level at a certain time or place. It can also be a derived data value, such as the circadian amplitude of a gene in a certain condition. | |
| basesequence | The promoter sequence starts off as 500 blank base pairs. The downstream region has been fixed to 50 base-pairs taken from the Cauliflower Mosiac virus minimal promoter region. If you would like to add your own motifs at this point, you can place them manually in the sequence. You can also add your own motifs one at a time during the design process. The total sequence length is currently fixed to 500 base pairs. | |
| selectdatabase | Pick the Gene Expression Database (AtGenExpress, DIURNAL) and the Motif Regulation database (ATTED-II, PPDB). Then pick the collection of Gene Expression Properties organized by type, such as tissues involved in the same organ (flowering), or data time courses taken in the same growth condition. | |
| selectrange | Choose the phase of the circadian rhythm to search for. 0 hours is defined as the first night to day transition. The light cycle conditions will depend on the particular experiment. | |
| gacccttcctctatataaggaagttcatttcatttggagaggacctcgac | This is the minimal promoter element from the CaMV35S promoter. Currently this sequence is fixed. | |
| hanadb | External data visualization by HanaDB, a database of plant tissue expression measurements, similar to AtGenExpress. This database also provides a picture representation of each plant tissue, with the gene expression level represented as a heat scale. | |
| efp | External data visualization by the Arabidopsis eFP browser. This is a visualization of the AtGenExpress data, showing the gene expression level in different tissues as a heat scale. | PubMed:17684564 |
| addanothermotif | User input of motif sequence and position. Use this if there is a particular motif you would like to add to your promoter design. You can continue to add motifs one at a time. | |
| replace | Add the motifs found from the data mining to the current promoter design. If you just want to add a single motif to the design, then enter the " Motif View " by clicking on a single motif in the alignment. | |
| finishnow | Finish the promoter design by filling in the remaining sequence of the promoter. The last gene selected will be used, and its promoter sequence will be put in place in every position without a motif sequence. All motif sequences, as well as the 50 base-pair minimal promoter, will remain preserved. | |
| next | Perform another data mining operation to find new motifs for the design. | |
Koro_Nishikata
Robert Cox
